Сравнительная характеристика молекулярно-биологического портрета опухолевой и перитуморальной тканей плоскоклеточного рака головы и шеи

Полный текст

Introduction

The most common morphological form of tumors of the head and neck is squamous cell carcinoma. According to data published by GLOBOCAN (2020), head and neck squamous cell carcinoma (HNSCC) ranks sixth in prevalence among other types of malignant neoplasms in the world. According to current data, HNSCC accounts for an estimated 890 000 incident cases of malignant neoplasms per annum, corresponding to approximately 4.5% of the global incidence of diagnosed cancers, and approximately 450 000 cancer-­related deaths annually [1]. This type of cancer is more common in adults over 50 years of age, with a male-dominated gender ratio (the ratio of men to women is approximately 2:1) [2]. To date, the increase in the incidence of acute respiratory viral infections among young able-bodied people has become socially significant. The main generally recognized etiological factors are tobacco smoking, alcohol consumption, infection with human papillomavirus (HPV) or Epstein-­Barr virus (EBV), as well as betel chewing, common among the peoples of Southeast Asia. Clinically, HNSCC is characterized by late diagnosis, aggressive course, locally widespread growth pattern, and frequent relapses [3]. The lack of screening leads to late diagnosis, complex anatomical localization complicates the radical surgical stage of treatment, and the proximity of critical structures leads to complications during RT. In the early stages of HNSCC (stages I and II), surgical treatment and RT are highly effective, with one- and two-year survival rates of 88.7 and 79.8%, respectively [4]. However, more than half of the patients (approximately 2/3 of the patients) already have a locally advanced form of the disease (stages III and IV) at the time of diagnosis, which is a prognostically unfavorable factor. Even with radical antitumor treatment, more than 40–50% of patients develop relapse, 20–30% of them develop distant metastases [5, 6], and the overall five-year survival rate is 25%. Patients with recurrent HNSCC have an unfavorable clinical prognosis with a median overall survival of about 12 months [7]. It was shown that in the most unfavorable cohort of patients (with a low–grade tumor negative for HPV type 16), the recurrence rate in the first six months after treatment is 50.6%, within 1 year — 72.5%, within 2 years — 88.6%. Such statistical data indicate the possible existence of a source of preserved or, conversely, induced by the therapeutic effect of tumor cells, which may be located near the localization of the primary tumor, namely, in the peritumoral tissue, which necessitates its study.

The aim of our study was to compare the structure and expression of genes in the tumor and peritumoral tissues of squamous cell carcinoma of the head and neck.

Based on a literature review, genes were selected that play a key role in tumor progression, including long-known regulators of tumor progression, as well as genes whose role in tumor growth has become known relatively recently.

Materials and methods

Characteristics of the biomaterial

The biopsy material of the tumor and peritumoral tissue (located at a distance of 2 cm from the tumor border) of the patients was obtained from the A. Tsyb Medical Radiological Research Center (MRSC). During the study, biomaterials from 35 patients obtained during the surgical stage of treatment were analyzed, information about patients is presented in the Table 1.

Biomaterial was obtained from patients meeting the following criteria:

1. Men and women over the age of 18.
2. Morphologically or radiologically verified diagnosis of squamous cell carcinoma in the head and neck (C00-C14, C30-C33).
3. General condition on the Karnovsky scale of at least 70 points.
4. Informed consent to participate in the study.

Table 1
General characteristics of patients

Parameters	Patients n, %
Total quantity	35 (100%)
Gender
Men Women	22 (62.8%) 13 (37.1%)
Age (years)
Median Range	57.3 19—83
Grade of malignancy
G1 G2 G3	25 (71.4.4%) 8 (22.8.8%) 2 (5.7.7%)
Keratinization
Keratinizing Non-keratinizing	17 (48.57%) 18 (51.4%)
T stage
1 2 3 4	3 (8.57%) 15 (42.8%) 10 (28.5%) 7 (20%)
N stage
0 1 2	9 (25.7%) 18 (51.4%) 8 (22.8%)
M stage
0 1	22 (62.8%) 13 (37.2%)
Localization
Oral cavity Tongue Larynx Maxillary sinus	15 (42.8%) 8 (22.8%) 10 (28.5%) 2 (5.7%)

Primary processing of the received material

The material was thoroughly washed from possible contaminating agents in a phosphate-salt buffer containing 0.02% EDTA (Versin solution), then in a phosphate-salt buffer containing 1× antibiotic-­antimycotic, then in a phosphate-salt buffer or Hanks solution without additives. In each solution, the tissue was washed 3 times. Then the material was divided into 2 unequal parts: the fragment was preserved in RNAlater solution for subsequent PCR-RT and stored at –80˚C until the study, the rest of the tissue was used for morphological examination.

Morphological examination

To verify the diagnosis of squamous cell carcinoma, a histological examination of the obtained tissue samples (tumor and peritumoral) was performed. Unfixed tissue samples were transferred to a foil mold filled with Tissue-­Tek O.C.T. Compound (Sakura Finetek), frozen at –80 °C until the mounting medium completely solidified, then stored at –20 °C until use. Cryosections with a thickness of 5 microns were made using a Leica CM1200 cryotome using Super Frost Gold (Menzel) glasses and dried at room temperature for 1 hour. For routine histological examination, cryosections were stained with hematoxylin and eosin, dehydrated in standard wiring, and enclosed in a mounting medium (Biovitrum). The survey was carried out using a Leica DM 4000 B direct microscope.

PCR-RT

The levels of mRNA expression of EGFR, PIK3CA, PTEN, YAP, SLC26A6, ARIH2, UBE2Z, and PITX1 genes were determined using real-time polymerase chain reaction in samples of tumor tissue and the peritumoral region (Table 2). The RNA Solo kit was used for RNA isolation, and the MMLV RT Kit (Evrogen, Russia) was used for reverse transcription. The amplification reaction with real-time detection was performed on a Real-­Time DTprime amplifier (DNA Technology, Russia). The relative mRNA concentration of these genes was calculated by direct data comparison using the formula: [A]0/[B]0 = E DC(T), where [A]0 is the initial concentration of the gene's mRNA in the PCR mixture, [B]0 is the initial concentration of GAPDH mRNA in the PCR mixture, E is the reaction efficiency (assumed to be 1.98), DC(T) is the difference between the threshold cycles of GAPDH and the desired gene.

Table 2
Sequences of used primers

Gene	Sequence
GAPDH	Forward	GCACCGTCAAGGCTGAGAAC
	Reverse	TGGTGAAGACGCCAGTGGA
EGFR	Forward	CCCCCTGACTCCGTCCAGTA
	Reverse	CCCAACTGCGTGAGCTTGTT
PIK3CA	Forward	TTCCGGGGGATTGTAGGCTC
	Reverse	TTCCGGGGGATTGTAGGCTC
YAP	Forward	CAGCAACTCCAACCAGCAGC
	Reverse	CAGCAACTCCAACCAGCAGC
SLС26A6	Forward	AGACAGCCAGAGATGCTGCC
	Reverse	GTAGGTGACCACGAAGCCGA
UBE2Z	Forward	CGGCACGAGACCATCAGAGT
	Reverse	TGGTAGTCAAAGTGGCCCCG
PTEN	Forward	CCCAGTCAGAGGCGCTATGT
	Reverse	CCCAGTCAGAGGCGCTATGT
TIMP1	Forward	CCTTCCAGGTGTTTCCCTGTT
	Reverse	CCTTCCAGGTGTTTCCCTGTT
TIMP2	Forward	GACCCACAAGGAGATTGGGG
	Reverse	GACCCACAAGGAGATTGGGG
PITX1	Forward	AACCGCTACCCCGACATGAG
	Reverse	CTGCACTAGGCCGCTGAACT

Statistical methods

The statistical analysis of the obtained data was carried out in the Statistica 8.0 program, using the Shapiro – Wilk test to assess the normality of the distribution, the Mann – Whitney criteria and the t-test for pairwise comparison. The differences were considered statistically significant at a significance level of p<0.05.

Results and discussion

In all the presented samples of tumor tissue, extensive invasion of tumor cells into their own plate of the mucous membrane was noted, and the integrity of the basement membrane was disrupted (Figure 1, 2). Histological preparations stained with hematoxylin and eosin revealed a pattern characteristic of squamous cell carcinoma: abundant invasive growth of tumor cells into the underlying tissues in the form of rounded clusters, strands or individual cells. Normal architectonics were preserved in the peritumoral tissue samples: the multilayer epithelium is separated from its own plate of the mucous membrane by a preserved basement membrane (Figure 1, 2).

Figure 1. Squamous cell carcinoma of the larynx: tumor (а) and peritumoral (b) tissues. Hematoxylin and eosin staining. Light-field microscopy. The length of the scale segment is 100 microns and 50 microns

Figure 2. Squamous cell carcinoma of the tongue: tumor (a) and peritumoral (b) tissues. Hematoxylin and eosin staining. Light-field microscopy. The length of the scale segment is 100 microns and 50 microns

The levels of mRNA expression of the PTEN, TIMP1, TIMP2, YAP, PIK3CA, EGFR, ARIH2, SLC26A6, UBE2Z, and PITX1 genes were evaluated using real-time polymerase chain reaction in tumor tissue and peritumoral tissue samples.

PTEN is a tumor suppressor gene that regulates the cell cycle and apoptosis by modulating the PI3K-PKB/Akt signaling pathway. Approximately 30% of cases of HNSCC have decreased PTEN expression. Moreover, the lack of PTEN expression often leads to the development of aggressive tumors and is associated with low disease-free and overall survival of patients [8, 9].

YAP is a transcriptional coactivator of genes involved in growth and tumor formation. Increased YAP expression is associated with an unfavorable prognosis of HNSCC and resistance to chemo and radiotherapy [10] (Figure 3).

 

Figure 3. The level of relative expression of the PTEN, YAP genes in tumor and peritumoral tissues
Tissue metalloproteinase inhibitors (TIMPs) block the activity of matrix metalloproteinases, which leads to suppression of tumor progression [11], but their role in HNSCC is controversial. There was no significant difference in the expression of these genes in the samples of tumor and peritumoral tissues studied by us (Figure 4).

Figure 4. The level of relative expression of the TIMP1 and TIMP2 genes in tumor and peritumoral tissues
PIK3CA is one of the most frequently mutating oncogenes in PRGS: mutations were detected in 13.7% of cases (TCGA, Firehose Legacy). PIK3CA encodes p110a, a Class 1A PI3K catalytic subunit. With abnormal activation, PI3K stimulates several downstream signaling cascades, which leads to uncontrolled proliferation, survival, and migration of tumor cells [12].

We found that the expression level of the epidermal growth factor receptor (EGFR) is significantly higher in tumor tissue than in peritumoral tissue (Figure 5). EGFR is overexpressed in more than 90% of cases of HNSCC, and its increased expression correlates with an unfavorable outcome in patients [13]. Binding of ligands to EGFR leads to a conformational change in the receptor, followed by autoactivation of tyrosine kinase from the intracellular domain of the receptor. This process activates the intracellular signaling pathway, which leads to inhibition of apoptosis, activation of cell proliferation and angiogenesis, as well as to an increase in the potential for metastatic spread [14].

Figure 5. The level of relative expression of PIK3CA and EGFR genes in tumor and peritumoral tissues
Note: * — p < 0.05

The ARIH2 gene is expressed everywhere, demonstrating the highest levels of expression in granulocytes [15]. Ubiquitin-­protein ligase E3, encoded by the ARIH2 gene, catalyzes the ubiquitination of target proteins and plays a key role in posttranslational modifications in various cellular processes. ARIH2 is involved in DNA repair under genotoxic stress [16].

The family of solute carrier proteins 26 (SLC26) includes multifunctional transporters of substrates, including oxalate, sulfate, and chloride, and plays an important role in the physiology and pathophysiology of the kidneys [17]. One of the members of this family, SLC26A6, is of particular interest because it has some non-canonical properties. For example, it has recently been demonstrated that SLC26A6 acts as an oncogene in hepatocellular carcinoma [18] and lung cancer [19]. In the studied samples, the expression levels of the ARIH2 and SLC26A6 genes were approximately the same in the tumor and peritumoral tissues (Figure 6).

Ubiquitination is one of the types of protein modification that modulates many cellular signaling processes, including DNA repair, transcription, cell membrane receptor recycling, intracellular transport, endocytosis, angiogenesis, and inflammatory signaling [20]. Ubiquitination occurs as a result of the joint work of three types of enzymes: ubiquitin-­activating enzymes (E1), ubiquitin-­conjugating enzymes (E2) and ubiquitin ligases (E3), respectively (Upregulation of ubiquitin-­conjugating enzyme E2Z is associated with human hepatocellular carcinoma). More and more studies show that most of the enzymes involved in ubiquitination play a significant role in the development of tumors [21]. Paired homeodomain transcription factor 1 (PITX1), also known as pituitary homeobox 1 (Ptx1), refers to highly conserved homeobox genes that encode sequence-­specific transcription factors (SSTFS) that are involved in osteogenesis [22]. It is assumed that PITX1 can act as a tumor suppressor gene and a potential biomarker for predicting the chemoresistance of tumor stem cells of HNSCC [23]. In our study, a decrease in the expression of this gene was noted in the samples of the tumor tissue of the HNSCC, compared with the tissue of the peritumoral region (Figure 7).

Figure 6. The level of relative expression of the ARIH2, SLC26A6 genes in tumor and peritumoral tissues

Figure 7. The level of relative expression of the UBE2Z and PITX1 genes in tumor and peritumoral tissues
Note: * — p < 0.05

Conclusion

Increased expression of EGFR and PIK3CA genes in tumor tissue confirms the activation of signaling pathways associated with tumor cell proliferation, survival, and progression. In contrast, the higher expression of the putative tumor suppressor gene PITX1 in peritumoral tissue suggests the preservation of regulatory mechanisms limiting malignant transformation outside the tumor focus.

The obtained results emphasize the importance of studying not only the tumor itself but also its surrounding peritumoral microenvironment, which may contribute to disease progression and recurrence. The identified molecular markers can be considered promising candidates for further studies aimed at improving prognostic assessment, identifying patients at high risk of relapse, and developing personalized therapeutic strategies for HNSCC.

Об авторах

Э. Д. Джуманиязова

Российский университет дружбы народов

Автор, ответственный за переписку.
Email: enar2017@yandex.ru
ORCID iD: 0000-0002-8226-0433
SPIN-код: 1780-5326
г. Москва, Российская Федерация

И. В. Арутюнян

Российский университет дружбы народов; Научно-исследовательский институт морфологии человека имени академика А.П. Авцына ФГБНУ «Российский научный центр хирургии имени академика Б.В. Петровского»

Email: enar2017@yandex.ru
ORCID iD: 0000-0002-4344-8943
SPIN-код: 5220-1893
г. Москва, Российская Федерация

А. Г. Соболева

Российский университет дружбы народов; Научно-исследовательский институт морфологии человека имени академика А.П. Авцына ФГБНУ «Российский научный центр хирургии имени академика Б.В. Петровского»

Email: enar2017@yandex.ru
ORCID iD: 0000-0002-9158-1933
SPIN-код: 2582-5511
г. Москва, Российская Федерация

П. А. Вишнякова

Российский университет дружбы народов; Национальный медицинский исследовательский центр акушерства, гинекологии и перинатологии имени академика В.И. Кулакова

Email: enar2017@yandex.ru
ORCID iD: 0000-0001-8650-8240
SPIN-код: 3406-3866
г. Москва, Российская Федерация

М. А. Гулиева

Российский университет дружбы народов

Email: enar2017@yandex.ru
SPIN-код: 3536-3784
г. Москва, Российская Федерация

А. В. Лохонина

Российский университет дружбы народов

Email: enar2017@yandex.ru
ORCID iD: 0000-0001-8077-2307
SPIN-код: 4521-2250
г. Москва, Российская Федерация

А. В. Макаров

Российский университет дружбы народов; Российский национальный исследовательский медицинский университет имени Н.И. Пирогова

Email: enar2017@yandex.ru
ORCID iD: 0000-0003-2133-2293
SPIN-код: 3534-3764
г. Москва, Российская Федерация

К. Б. Гордон

Российский университет дружбы народов; Медицинский радиологический научный центр им. А. Цыба - филиал Национального медицинского исследовательского центра радиологии

Email: enar2017@yandex.ru
ORCID iD: 0000-0002-3146-5615
SPIN-код: 2045-4565
г. Москва, Российская Федерация; г. Обнинск, Российская Федерация

Список литературы

Дополнительные файлы